E-Book

E-Book 2nd Congress

  • Prevalence of C. burnetii DNA in sheep milk in the Eilam province of Iran
  • Shirin Mohammadipour,1,* Ahmad Enferadi,2 Afshin Ajdari,3 Saeedeh Sarani,4 Sepideh Asadi,5 Marjan Khorasani Nejad,6
    1. Kerman university
    2. Urmia University
    3. Urmia university
    4. Zabul university
    5. Tehran university
    6. Kerman University


  • Introduction: Coxiella burnetii a member of family Rickettsiaceae is the causative agent of Q fever. C. burnetii is generally considered as a small micro- organism (0.2–0.4 μm wide by 0.4–1.0 μm long). With a cell wall si- milar to that of a Gram-negative bacterium. This bacterium has been detected in many animals including domestic and wild animals, pets, reptiles, and birds. Domestic ruminants are the main reservoirs for C. burnetii, playing an important role in Q fever infections in humans. The duration of C. burnetii excretion in milk is different in domestic animals, so that cows, goats, and ewes excrete the bacterium in milk for 13 months, 52 days, and eight days respectively. Shedding of C. burnetii in milk was sporadic and concentrated in the first month after parturition, whereas excretion in vaginal dis- charges and feces continued for longer. Similar results were reported by, although in the current study the shedding period was longer and for up to 150 days after parturition in fecal samples and up to 90 days in vaginal discharges. At 2 and 6 weeks later, treated animals continued shedding the bacteria and there were no significant differences in the number of shedders between treated and control groups. Moreover, the bacteria were excreted in feces for 5 months after parturition, for 3 months in vaginal discharges and for 4 months in milk.
  • Methods: A number of 315 milk samples were randomly collected from sheep sheep farms randomly selected in three different geographical regions of west Eilam in 2022. Sampling of apparently healthy animals was performed. Lambing and kidding usually occur in February and March. The collected milk samples were placed on ice and immediately transferred to the microbiology laboratory at the Faculty of Veterinary Medicine. DNA extraction from re-suspended pellet was performed using Blood Genomic DNA Extraction Mini Kit, (Favorgen, Taiwan) according to the kit's manufacturer instructions. The quality and quantity of the ex- tracted DNA was evaluated by Nano Drop 2000c (Termo Scientific, USA). The extracted DNA from samples was kept at −20 °C for the later use in PCR. During DNA extraction procedure, elution buffer from the extraction kit was used as Negative Control of Extraction. Molecular detection of C. burnetii For the molecular detection of C. burnetii, nested-PCR targeting the transposon IS1111 gene was employed. The PCR products for both stages were electrophoresed on a 2% agarose gel containing safe stain (Labnet, ENDUROTM, USA) and then visualized using in genius Gel Documentation (Syngene Bio-Imaging, UK). Trans-PCR F: TATGTATCCACCGTAGCCAGTC R: GAGCGAACCATTGGTATCG nested-PCR FN: CCCAACAACACCTCCTTATTC RN: CTTTAACAGCGCTTGAACGT
  • Results: Nested-PCR amplification of IS1111 gene C. burnetii DNA 13 out of 315 milk samples were positive for the presence of C. burnetii DNA (4.1%; 95% CI: 2.4% – 6.9%). milk samples from sheep, were positive for C. burnetii.
  • Conclusion: It was concluded that sheep can play an important role in the epidemiology of Q fever as the reservoir for C. burnetii. The mole- cular detection of C. burnetii using Nested-PCR method in milk samples showed that PCR can be used an easy and reliable approach for de- tecting Q fever. Therefore, the consumption of sheep milk expose human at the higher risk of Q fever.
  • Keywords: Coxiella burnetii, Nested-PCR, Sheep milk, Eilam province